Skip to main content
Download PDF

Effect and mechanism of miRNA-144-5p-regulated autophagy in older adults with Sarcopenia

Immunity & Ageing volume 22, Article number: 7 (2025) Cite this article

Abstract

Background

Advanced aging invariably triggers an overabundance of apoptosis, stemming from diminished autophagy or a disarray in cellular autophagic processes. This, in turn, leads to an accelerated breakdown of muscle proteins, which exacerbates the ongoing deterioration of skeletal muscle and intensifies the severity of senile sarcopenia. This study aimed to investigate the role and mechanism of miRNA-regulated autophagy in senile sarcopenia.

Methods

The miRNAs associated with sarcopenia were screened, and the target genes of significant miRNAs were predicted. The effects of significantly differentially expressed miRNA-144-5p on cell aging and autophagy were validated in vivo and in vitro.

Results

The inhibition of miR-144-5p enhanced the multiplication of mouse myoblasts, increased the expression of MHC and autophagic markers LC3II/LC3I and Beclin-1, facilitated the formation of autophagosomes in mouse myoblasts, and reduced the number of aging cells and the expression of senescence-related proteins acetylated p53, p53, and p21 expression in mouse myoblasts. miR-144-5p affects myoblast senescence, myogenic differentiation, and autophagy by regulating the downstream target gene, Atg2A. Inhibiting miR-144-5p markedly increased the grip strength of the posterior limb in old mice, and the CSA of old mice and young mice was also markedly increased.

Conclusion

All experiments have demonstrated that miRNA-144-5p has a significant impact on the regulation of autophagy and the development of senile sarcopenia.

Background

Sarcopenia is a muscular disease associated with aging that is characterized by a gradual decline in skeletal muscle mass and function [1]. Currently, there are 50 million victims of sarcopenia worldwide, and the number of patients is estimated to be as high as 500 million people will be affected by 2050 [2, 3]. The occurrence of sarcopenia in older Asian adults is between 4.1% and 11.5%, which is lower than that in Europe and the United States [4]. Etiology of sarcopenia is multifactorial, encompassing chronic inflammation, insulin resistance, mitochondrial dysfunction, motor neuron degeneration, hormonal dysregulation associated with aging, and genetic predispositions [5, 6]. It is associated with multiple health risks, including falls, declining physical function, reduced quality of life, physical disability, depression, and increased hospitalization and mortality [7, 8].

As the functions of RNA continue to be deciphered, the biopharmaceutical industry is increasingly exploring the potential of RNA therapies in the field of disease treatment. Currently, the most prominent RNA drugs include antisense oligonucleotides (ASOs), small interfering RNAs (siRNAs), and messenger RNAs (mRNAs). To date, nine ASOs drugs have received food and drug administration approval, including Formivirsen, Mipomersen, Nusinersen, Eteplirsen, Inotersen, Golodirsen, Volanesorsen, Viltolarsen and Casimersen, which are crucial for the treatment of rare genetic diseases [9]. Compared to traditional drugs based on protein structure and function, RNA drugs offer advantages in terms of druggability, selectivity, production efficiency, and particularly drug persistence [10]. They are suitable for a range of rare diseases caused by gene mutations. However, technical challenges related to drug stability, immunogenicity, and delivery systems remain to be fully addressed [11]. With ongoing breakthroughs in RNA formulation technologies, the application of RNA drugs in the prevention and treatment of human diseases holds significant promise.

Autophagy is a cellular process that degrades impaired organelles and surplus or aberrant proteins via lysosomes, thereby stabilizing the intracellular environment through the equilibrium of cellular synthesis and catabolism [12]. Studies have indicated a marked dysfunction in autophagy-dependent signaling in sarcopenia [13]. In denervation caused by muscle autophagy, the marker-related proteins involved in autophagy are significantly expressed, which activate the autophagy system and promote the loss of muscle cells [14]. Insufficient autophagy leads to abnormal accumulation of misfolded proteins, whereas excessive autophagy leads to cell stress and loss of skeletal muscle owing to increased protein degradation [15]. As aging progresses, degradation of proteins outpaces their synthesis, resulting in an imbalance of protein homeostasis that invariably leads to loss of skeletal muscle mass or muscle atrophy. A cross-sectional study involving 60 volunteers investigated the levels of autophagy markers in skeletal muscle across different groups (young, old non-frail, old pre-frail, and old frail individuals). Compared to the young group, all elderly groups exhibited lower muscle strength. Perforated muscle biopsies of the vastus lateralis showed higher levels of microtubule-associated-protein-light-chain-3-II (LC3-II) in older individuals [16]. Furthermore, another study based on muscle biopsies from patients with sarcopenia revealed that sarcopenia is associated with impaired mechanistic target of rapamycin (mTOR) signaling and increased autophagy, as indicated by elevated Beclin-1 and LC3 mRNA levels. This further underscores the complex regulatory mechanisms of autophagy in sarcopenia [17]. Improvements in basal autophagy have been shown to prevent the onset of sarcopenia in the elderly [18]. Therefore, understanding the regulatory mechanisms of autophagy is crucial for developing effective interventions for sarcopenia.

MicroRNAs (miRNAs), which are short (20–22 nucleotides) endogenous non-coding RNAs and they perform essential functions within a spectrum of biological processes, encompassing metabolism, development, cancer, and aging [19, 20]. Specifically, miRNAs have been found to be crucial for regulating satellite cells, facilitating myogenesis induction, maintaining muscle protein homeostasis, preventing neurodegeneration, and inhibiting fatty infiltration in the muscle [21, 22]. Recently, miRNAs were shown to be closely involved in the development and progression of sarcopenia. Research has shown that certain miRNAs are differentially expressed during the aging process and contribute to the tissue- or cell-specific aspects of aging [23]. The above studies highlight the crucial role of miRNAs in muscle aging. Skeletal muscle-specific knockout of mice leads to low expression of specific miRNAs, decline of skeletal muscle mass, and abnormal muscle fiber morphology, underscoring the vital importance of proper miRNA maturation for both muscle growth and function [24].

Previous studies have reported that MiR-144-5p is involved in various diseases, including tumors, inflammatory diseases, and immune disorders. These studies have shown that miR-144-5p exerts anti-inflammatory effects and provides translational evidence that miR-144-5p is a new potential therapeutic target for different diseases [25,26,27]. In a study conducted by Li et al., was found that miR-144-5p may regulate the progression of chronic periodontal inflammation through cyclooxygenase-2 (COX2), Interleukin 17 F (IL17F) or other autophagy-related genes in the autophagy process, so this study may provide effective approaches and potential therapeutic targets for the treatment of chronic periodontitis [25]. In addition, a previous study has demonstrated that the overexpression of miR-144-5p inhibited the secretion of tumor necrosis factor-alpha (TNF-α), IL-6 and IL-8 and reduced THP‑1 macrophage cell viability in lipopolysaccharide (LPS)-treated THP-1 macrophages by suppressing toll-like receptor 2 (TLR2) expression and the activation of nuclear factor kappa-light-chain-enhancer of activated B cells (NK‑κB) signaling. Therefore, miR‑144‑5p may serve as a novel therapeutic target for rheumatoid arthritis [27]. It was also reported that miR-144-5p inhibited antibacterial autophagy and the immune response through repressing DNA damage-regulated autophagy modulator2 [26].

The miRNAs associated with sarcopenia were screened using Gene Expression Omnibus (GEO) datasets in this study, and the target genes of significant miRNAs were predicted. The functions and signaling pathways involved in the target genes were analyzed using Gene ontology (GO) and Genes and Genomes (KEGG) enrichment analyses. We selected differentially expressed miRNA-144-5p to verify its regulatory role in autophagy and the aging process within the context of sarcopenia. This study provides a novel therapeutic target for the clinical treatment, particularly ASOs therapeutics of sarcopenia.

Materials and methods

Bioinformatics analysis

The data were sourced from the GEO database and included miRNA dataset of skeletal muscle samples from 19 young and 17 old male subjects (GSE23527) https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? acc = GSE23527 [28].

Differentially expressed miRNAs (DE miRNAs) were analyzed using the Limma software package in R. The screening conditions for DE miRNAs were p < 0.05, and |log2FC| > 1.0. GO and functional enrichment analysis of DE miRNAs’ target genes were performed using the R language clusterprofiler package [29]. Kyoto Encyclopedia of KEGG pathway enrichment analysis was also performed on target genes using ClueGO, a plugin application of Cytoscape [30].

Cell culture

C2C12 cells (mouse myoblasts) were sourced from Wuhan Procell Life Science & Technology Co., Ltd. Cells were cultured in DMEM medium (BasalMedia, L110KJ) containing 10% FBS and 1% penicillin-streptomycin (Beyotime, C0009), and placed in a cell incubator with 37 °C and 5% CO2. After the cells grew to a density of 80-90% in the culture flask, they were subcultured at 1:2. Cell morphology was observed under BLD-200 inverted biological microscope (Cossim, Beijing, China). The number of cells was increased greatly, and the cells at passages 3–10 were used for subsequent experiments. Each experiment was performed with three biological replicates, and each replicate included three technical replicates to minimize operational errors.

Induction of myogenic differentiation in C2C12 cells

C2C12 cells were cultured on glass coverslips with 2% horse serum for 7 days to induce myogenic differentiation. The expression of myosin heavy chain (MHC) was assessed by immunofluorescence and Western blotting (WB) to evaluate myotube formation.

Animal modeling

Old male C57BL/6 mice aged 24 months and young male mice aged 5 months were injected with the corresponding drugs by group. Experimental animals were divided into four groups: old mice + antagomir-NC, young mice + antagomir-NC, old mice + miRNA antagomir, and young mice + miRNA antagomir. Groups of mice (n = 6) were intraperitoneally injected with the antagomir (GenePharma, Suzhou, China). Before the injection, we measured the body weight of mice in each group, and there were no significant differences (Supplementary Fig. 1). The concentration of antagomir was 2 nmol/10 µL, and each mouse was injected intramuscularly with 50 µL into the gastrocnemius muscle of both sides. Mice were injected every 3 days for 2 weeks.

Cell grouping treatment

Cells cultured in six-well plates in a stable growth state were harvested and randomly divided into four groups: mimic-NC, hsa-miR-144-5p mimic, inhibitor-NC, and hsa-miR-144-5p inhibitor groups. First, four 1.5 mL EP tubes were prepared, and 10 µL mimic-NC, hsa-miR-144-5p mimic, inhibitor-NC, and hsa-miR-144-5p inhibitor (the concentrations are all 1 µg/mL) were dissolved in 490 µL OPTI-MEM (Gibco, 31985-062) and mixed gently for incubation for 5 min at room temperature (TM). Then, another four 1.5 mL EP tubes were prepared and 30 µL of transfection reagent Nanofusion version 2.0 (Biomedicine, 10668-006) was respectively into 470 µL of OPTI-MEM, mixed gently, and allowed to stand at TM for 5 min. The mixture in the EP tubes containing the transfection reagent was transferred to the corresponding centrifuge tubes, mixed well, and allowed to stand at the TM for 15 min. The cells were aspirated back and forced three times using a 1 mL pipette tip, transferred to 6-well plates evenly, mixed well using a crossing method, and cultured back in the incubator. After 6 h, the medium was replaced with a fresh complete medium. Follow-up experiments were performed after 48 h of culture.

hsa-miR-144-5p mimic: GGAUAUCAUCAUAUACUGUAAG.

hsa-miR-144-5p inhibitor: CUUACAGUAUAUGAUGAUAUCC.

mimic-NC: UCACAACCUCCUAGAAAGAGUAGA.

inhibitor-NC: UCUACUCUUUCUAGGAGGUUGUGA.

To investigate the effect of miR-144-5p on myoblast aging and myogenic differentiation through autophagy regulation, we used 3-methyladenine (3-MA, MCE, HY-19312) to inhibit autophagy in cells. Specifically, stable cells were seeded into 6-well plates and cultured. The cells were randomly divided into four groups: inhibitor-NC group, has-miR-144-5p inhibitor group, inhibitor-NC + 3-MA group, and has-miR-144-5p inhibitor + 3-MA group. For the 3-MA groups, cells were cultured in complete medium containing 5 mM 3-MA for 24 h. Afterward, cells were transfected according to their respective groups with either inhibitor-NC or has-miR-144-5p inhibitor. For transfection, 10 µL of inhibitor-NC or has-miR-144-5p inhibitor was dissolved in 490 µL OPTI-MEM and incubated for 5 min. Then, 30 µL of Nanofusion transfection reagent was added to 470 µL OPTI-MEM, and the mixture was left to stand for 5 min. The transfection solution was then added to a corresponding centrifuge tube containing the respective plasmids and incubated for 15 min. After mixing thoroughly, the solution was added to the 6-well plates, and the cells were evenly mixed using a cross-pattern shaking method before being returned to the incubator for continued culture. After 6 h, the medium was replaced with fresh complete medium. Cells were cultured for another 48 h post-transfection before subsequent experimental analysis.

To investigate whether miR-144-5p regulates the target gene to influence myocyte senescence, myogenic differentiation, and autophagy, we constructed an autophagy-related protein 2 A (Atg2A) overexpression plasmid. The Atg2A gene sequence was amplified from a cDNA library by PCR, and subsequently cloned into the pCDNA3.1(+) expression vector via restriction enzyme digestion and ligation. Transfection experiments were performed as described above. Based on the experimental groups, the following plasmid treatments were applied: mimic-NC, hsa-miR-144-5p mimic, mimic-NC + Atg2A, and hsa-miR-144-5p mimic + Atg2A. For each group, 10 µL of the corresponding plasmid was added. After transfection for 48 h, cells were collected for subsequent analysis.

Detection of cell proliferation

The cells were treated with 5-Ethynyl-2’-deoxyuridine (EdU) solution pre-warmed (Beyotime, C0081S) at 37 °C for 2 h. After removing the culture medium, the cells were fixed in 4% paraformaldehyde (Leagene, DF0135) for 15 min at the TM and then washed three times with PBS for 3–5 min per wash. The cells were permeabilized with a solution containing 0.3% TritonX-100 (Beyotime, ST795) in TM for 10–15 min. Following this, the cells were washed once or twice with a washing solution and then incubated with click reaction solution for 30 min in the dark at TM. After removing the click reaction solution, the cells were washed three times with PBS for 3–5 min each and then stained with DAPI solution (Beyotime, C1006) at TM for 10 min in the dark. Finally, after washing three times with PBS for 3–5 min each, the samples were analyzed using fluorescent inverted microscope (MF53-LED; Guangzhou Micro-shot Technology Co., Ltd).

Immunofluorescence

The fixed cell slides were washed using PBS 3 times with PBS for 5 min each. After blocking with goat serum (Beyotime, C0265) at TM for 30 min, sections were incubated with primary antibodies (dilution rate 1:500) at 4 °C overnight. The specimens were then washed with PBS, followed by incubation with the secondary antibody (dilution rate 1:200) in the dark at TM for 1.5 h. The specimens were then washed with PBS. Nuclear staining was performed by adding DAPI drops (stock solution, Beyotime, C1005) and incubating the specimens for 5 min in the dark. After washing with PBS, the slides were sealed with an anti-fluorescence quencher (Beyotime, P0126) and photographed using an inverted Mshot MF53-LED microscope (Guangzhou Micro-shot Technology Co., Ltd). Antibodies included MHC rabbit mAb (myosin heavy chain (MHC) (ABclonal, Wuhan, A25357) and FITC goat anti-rabbit IgG (ABclonal, Wuhan, AS011).

β-galactosidase (β-GAL) staining

A β-GAL Staining Kit (Regan, China, DE0021) was used for the staining. The cells were washed with PBS and fixed with a β-GAL staining fixative at the TM. After washing with PBS, cells were incubated with the staining working solution (500 µL/well) overnight at 37 °C. The staining solution was discarded, and the cells were added with PBS and observed under a fluorescent inverted microscope (MF53-LED; Guangzhou Micro-shot Technology Co., Ltd).

Monodansylcadaverine (MDC) staining

The slides were washed with PBS and incubated with MDC staining solution (China, Beyotime, C3019S-1) at 37 °C for 30 min in the dark. The staining solution was then removed and the cells were washed with Assay Buffer (Beyotime, China, C3019S-3) three times with 0.8-1 ml Assay Buffer each time. Nuclear staining was performed with DAPI (Beyotime, C1005), culture in vitro for 5 min and conduct nuclear staining. After washing with PBS, the slides were sealed using an anti-fluorescence quencher. Green fluorescence was observed under a fluorescence microscope. Sections were photographed using a fluorescent inverted microscope (MF53-LED; Guangzhou Micro-shot Technology Co., Ltd).

Dual-luciferase reporter assay

A 409 bp sequence at the 3’UTR region of Atg2A which contains the binding site of hsa-miR-144-5p to the Atg2A 3’UTR, with the sequence 5’-GAUAUCA-3’ was synthesized and cloned into the dual luciferase reporter vector pmiRGLO as Atg2A-3’UTR-WT-luc2-Rluc. The binding site of Atg2A 3’UTR was mutated (GATATCAT mutated to tagccgct) and cloned into the pmiRGLO vector as Atg2A-3’UTR-MUT-luc2-Rluc. Plasmid co-transfection was performed by mixing 1 µg of each plasmid with 50 µL of culture and 1.6 µL of Nanofusion transfection reagent (Biomedicine, 10668-006) and incubating for 5–20 min at TM before culturing in a 12-well plate. Passive Lysis Buffer was added to each well and shaken at TM for 15 min before transferring the cell lysate to a new centrifuge tube and then centrifuged at 12,000 rpm at 4 °C for 10 min. Luciferase assays were conducted using 100 µL of Luciferase Assay Reagent II (Promega, USA) and Stop &Glo® Reagent to measure firefly luciferase values and Rinella luciferase values, respectively. The Fluc luciferase activity was normalized to the Rluc luciferase activity, and the Relative Luciferase Activity (RLA) was calculated using the formula: RLA = Fluc/Rluc. At least three independent experiments were performed, with three replicate wells for each condition. The mean and standard deviation (SD) of the RLA for each experimental condition were calculated, and a bar chart was generated to represent the data.

WB

Both cell and mouse skeletal muscle protein extraction use RIPA lysis buffer (containing PMSF and protease inhibitor cocktail) to remove cell debris or tissue impurities by centrifugation. For cell extraction, a 3000 rpm centrifugation step is applied to remove the pellet, while tissue is homogenized using a grinder. After extraction, samples are centrifuged at 13,000 rpm for 20 min to collect the supernatant, which is stored at -80 °C for later use. The protein concentration was determined using a BCA (Bicinchoninic Acid) protein assay kit (Beyotime, P0012). Total proteins (500 µg) from each sample were mixed with 5×SDS loading sample buffer at a ratio of 4:1 and denatured by heating at 100 °C for 6 min. 60 µg of denatured total protein was taken for sample loading. After the condensed gel was set to 80 V, electrophoresis was performed at 120 V. The membrane transfer was conducted using a constant current of 250 mA. The transfer was carried out on a PVDF membrane activated with methanol (Amersham, 10600023) for a duration of “1 kDa/min + 30 min” ensuring efficient protein transfer with sufficient time for proteins to bind to the membrane [31]. The primary antibody (1:1000) was incubated at 4 °C overnight, and then incubated with a secondary antibody (1: 2000, abclonal, AS014, China) was incubated at TM for 1.0 h. Subsequently, ECL exposure solution was used for strip color development observation. For quantification of protein expression, ImageJ software was used to calculate the grayscale values of the bands. The relative protein expression levels of the samples were normalized to GAPDH as an internal control. Primary antibodies used were MHC (abclonal, China, A25357), Acetyl-p53 (abclonal, China, A16324), p53 (abclonal, China, A19585), p21 (abclonal, China, A19094), LC3 (abclonal, China, A19665), Beclin-1 (abclonal, China, A7353), p62 (abclonal, China, A19700), Atg2A (abclonal, China, A8576), and GAPDH (abclonal, China, A19056).

qPCR

Total RNA was extracted from the lysate of RNAiso Plus (Takara, 9108, Japan), and the absorption peaks and ratios of each group of RNA at 230, 260, and 280 nm were determined by spectrophotometry. cDNA was obtained using cDNA Synthesis Kit (Beijing, Tsingke, TSK302M). Quantitative PCR was performed using kit (SYBR Green I) (Beijing, Tsingke, TSE002). The detection of miR-144-5p used U6 as the internal reference gene, and the detection of Atg2A used GAPDH as the internal reference gene. The quantitative primers used were as follows.

miR-144-5p-F: CTGCACGGATATCATCATAC;

miR-144-5p-R: GTGCAGGGTCCGAGGT;

Atg2A-F: TCCCGTCTCCGTCTATCTGTT;

Atg2A-R: CGTCCCCTTCCTCTTCGTTTT;

U6-F: CTCGCTTCGGCAGCACATATACT;

U6-R: ACGCTTCACGAATTTGCGTGTC;

GAPDH-F: CTGGGCTACACTGAGCACC;

GAPDH-R: AAGTGGTCGTTGAGGGCAATG.

Grip strength test in the posterior limb of mice

Posterior limb strength of the mice was measured using a grip tester (KeyueHuacheng, Beijing, China). The mouse was placed on a platform base anterior to the grab bar. The tail of the mouse was grabbed and pulled straight backwards (animals when passively moved backwards instinctively grab anything to prevent the reverse until the pulling force exceeds the grip strength). After the animal grip strength disappeared, the preamplifier automatically recorded the maximum pulling force and displayed it on an LCD screen. The grip strength test was performed three times for each mouse. Statistical analysis was performed after all experimental and control groups were measured.

Hematoxylin and eosin (HE) staining

Muscle tissues were fixed in 4% paraformaldehyde (Leagene, DF0135) and embedded in paraffin. The paraffin sections were dewaxed in xylene I, II, and 1/2 xylene, rehydrated in ethanol, and then washed. Tissues were sectioned and stained with HE. After staining, the slides were dehydrated and mounted with neutral resin (Sinopharm, 10004160) [32]. Finally, observed under a microscope (MF53-LED; Guangzhou Micro-shot Technology Co., Ltd). and myofiber area was measured using ImageJ software.

Statistical analysis

All analytical assessments were blinded to the maximum practical extent. DecisionLinnc. 1.0 was used for the data analysis [22]. All data are presented as mean ± SD. The statistical significance of both groups was assessed using the t-test. ANOVA was used for comparison between multiple groups, and one-way ANOVA and Tukey’s post hoc test were used when the data met the normal distribution; the Friedman test was used when the data did not meet the normal distribution. A p-value less than 0.05 indicated a statistically significant difference.

Results

Screening of differentially expressed miRNAs and their downstream target genes

Dataset GSE23527 was utilized, and 83 differentially expressed miRNAs in old and young skeletal muscles of humans were obtained, compared with young subjects, 28 of which were significantly upregulated and 55 declined at p < 0.05, and |log2FC| > 1.0. The top 50 differentially expressed miRNAs are shown as the following heatmap (Fig. 1A). KEGG and GO enrichment analysis was performed on the top 50 differentially expressed miRNA target genes. KEGG enriched pathways included the PI3K-Akt signaling pathway, proteoglycans in cancer, and various cancers. Biological processes in GO terms included epithelial cell proliferation, regulation of apoptotic signaling pathway, and positive regulation of cell adhesion; cellular components included focal adhesion and cell-cell junction; molecular functions included DNA-binding transcription activator activity, RNA polymerase II -specific, and growth factor binding.

Fig. 1
figure 1

Differentially expressed miRNA analysis. (A) Heatmap of the top 50 differentially expressed miRNAs. (B-C) KEGG and GO enrichment analyses of predicted miRNA target genes

Full size image

Effects of Mir-144-5p on myoblast proliferation, senescence, myogenic differentiation and autophagy

The expression of miR-144-5p is significantly downregulated in the muscles of cachectic patients with non-small cell lung cancer [33]. miR-144-5p exhibits anti-tumor activity in glioblastoma cells, Ginsenoside Rd inhibits the proliferation and migration of glioblastoma cells by upregulating miR-144-5p [34]. Studies have shown that miR-144-5p can affect myoblast proliferation [35]. However, its research on sarcopenia is still less reported. Therefore miR-144-5p was identified as a candidate for further research. The mouse myoblasts C2C12 were divided into four groups: mimic-NC, hsa-miR-144-5p mimic, inhibitor-NC, and hsa-miR-144-5p inhibitor. Mouse myoblasts were labeled with EdU to detect proliferation. The findings demonstrated that inhibiting miR-144-5p promoted the proliferation of mouse myoblasts, whereas overexpression of miR-144-5p suppressed cell proliferation (Fig. 2A).

To elucidate the effect of miR-144-5p on mouse myoblast senescence, we used a β-GAL staining kit to stain senescent cells (Fig. 2B). Compared with the mimic-NC group, the intensity of senescence-associated β-GAL (SA-β-GAL) staining in the hsa-miR-144-5p mimic group increased, whereas that of the hsa-miR-144-5p inhibitor group was lower than that of the inhibitor-NC group. Overexpression of miR-144-5p promoted the senescence of myoblasts, whereas inhibition of miR-144-5p reduced the number of senescent cells.

Fig. 2
figure 2

Myoblast proliferation and senescence analyses. (A) Microscopic observation of the EdU staining results of cells in each group at 100×. (B) β-galactosidase staining. Scale bar = 100 μm. * p < 0.05, ** p < 0.01 vs. mimic-NC or inhibitor NC (ANOVA analysis followed by Tukey’s post hoc test). The error bars represent standard deviation (SD), n = 3

Full size image

Major MHC constitutes an integral part of myosin and is essential for sustaining normal muscle cell function. To verify the role of miR-144-5p on the expression of MHC proteins in mouse myoblasts, we detected MHC expression in the four groups (Fig. 3A-C). Compared to the mimic-NC, MHC expression in the hsa-miR-144-5p mimic group was markedly decreased (p < 0.05), while it notably increased in the hsa-miR-144-5p inhibitor group (p < 0.05). This indicated that miR-144-5p inhibition promoted MHC expression.

Senescence-related proteins acetylated p53, p53, and p21, the expression and ratios of autophagy markers LC3II/LC3I and the expression of Beclin-1 and p62 in each group were detected by WB (Fig. 3D). Acetylated p53, p53, p21, and p62 proteins expression was markedly elevated in the hsa-miR-144-5p mimic group compared to the mimic-NC group, but substantially reduced in the hsa-miR-144- 5p inhibitor group compared to the inhibitor-NC (p < 0.05). Beclin-1 protein expression was greatly diminished in the hsa-miR-144-5p mimic group, but markedly elevated in the hsa-miR-144-5p inhibitor group (p < 0.05). LC3II/LC3I expression was markedly reduced in the hsa-miR-144-5p mimic group (p < 0.05), but increased in the hsa-miR-144-5p inhibitor group (p < 0.05).

Fig. 3
figure 3

Analysis of MHC, acetyl-p53, p53 and p21, autophagy markers LC3II/LC3I, Beclin-1 and p62 expression in each group. (A-B) Immunofluorescence and Western blot detection of MHC protein expression. (C-D) Western blot detection of the expressions of acetyl-p53, p53 and p21, autophagy markers LC3II/LC3I, Beclin-1 and p62 in each group. Scale bar = 50 μm. * p < 0.05, ** p < 0.01 vs. mimic-NC or inhibitor NC (ANOVA analysis followed by Tukey’s post hoc test). The error bars represent standard deviation (SD), n = 3

Full size image

MDC is widely employed as a fluorescent probe for the detection of autophagy. It operates through ion capture and specific binding to membrane lipids, thereby specifically labeling autophagosomes, also known as autophagic vacuoles. Therefore, it is typically used method for autophagy detection. Treated mouse myoblasts were stained with MDC, and their expression was analyzed by detecting the green fluorescence intensity. q-PCR detection proved that miR-144-5p expression in the miR-144-5p mimic group was significantly increased compared to that in the mimic-NC (p < 0.05), while there was no significant difference in other groups (Fig. 4A). Compared with the mimic-NC group, a small number of autophagosomes were observed in the cells of the hsa-miR-144-5p mimic group, whereas a large number of autophagosomes were observed in the cells of the hsa-miR-144-5p inhibitor group compared with the inhibitor-NC group (Fig. 4B). Electron microscopy examination revealed that the morphological structure of the hsa-miR-144-5p mimic group was normal, with a small amount of autophagosomes seen in the cytoplasm; many autophagosomes were found in the mimic-NC and inhibitor-NC groups, and numerous autophagosomes were found in the cytoplasm of the hsa-miR-144-5p inhibitor group (Fig. 4C).

Fig. 4
figure 4

Autophagy detection. (A) q-PCR detection of miR-144-5p expression. (B) MDC staining. (C) Observation of autophagosomes by electron microscopy. Yellow arrows indicate nucleus, and red arrows indicate autophagosomes. Scale bar = 50 μm in Fig. 4B and scale bar = 2 μm in Fig. 4C. ** p < 0.01 vs. mimic-NC or inhibitor NC (ANOVA analysis followed by Tukey’s post hoc test). The error bars represent standard deviation (SD), n = 3

Full size image

MiR-144-5p affects myoblast senescence and myogenic differentiation by regulating autophagy

To further validate the regulatory role of miR-144-5p in autophagy, muscle cell senescence, and myogenic differentiation, experiments were reorganized into inhibitor-NC, hsa-miR-144-5p inhibitor, inhibitor-NC + 3-MA, and hsa-miR-144-5p inhibitor + 3-MA. β-GAL staining indicated that compared with the inhibitor-NC group, SA-β-GAL staining intensity in the inhibitor-NC + 3-MA group was increased, but decreased in the hsa-miR-144-5p inhibitor group, with little change observed in SA-β-GAL staining intensity in the hsa-miR-144-5p inhibitor + 3-MA group (Fig. 5A). Compared with the inhibitor-NC group, MHC expression in the inhibitor-NC + 3-MA group was markedly decreased (p < 0.05), while that in the hsa-miR-144-5p inhibitor group was significantly increased (p < 0.05) (Fig. 5B-C).

Fig. 5
figure 5

Myoblast senescence and MHC expression analysis. (A) β-galactosidase staining. (B-C) Western Blot and Immunofluorescence detection of the expression of MHC protein. Note: Scar bar = 100 μm. * p < 0.05, ** p < 0.01 vs. inhibitor NC (ANOVA analysis followed by Tukey’s post hoc test). The error bars represent standard deviation (SD), n = 3

Full size image

WB analysis indicated that acetylated p53, p53, p21, and p62 proteins expression was significantly reduced in the hsa-miR-144-5p inhibitor group, while those of the inhibitor-NC + 3-MA group were significantly increased (p < 0.05), compared to inhibitor-NC. Beclin-1 protein levels were significantly increased in the hsa-miR-144-5p inhibitor group but significantly decreased in the inhibitor-NC + 3-MA group (p < 0.05). The expression of LC3II/LC3I significantly increased in the hsa-miR-144-5p inhibitor group (p < 0.05) whereas considerably decreased in the inhibitor-NC + 3-MA group (p < 0.05). The expression of proteins in the hsa-miR-144-5p inhibitor + 3-MA group was similar to that in the control group, with no significant difference (Fig. 6).

Fig. 6
figure 6

Western blot detection of the expression of acetyl-p53, p53 and p21, autophagy markers LC3II/LC3I, Beclin-1 and p62 in each group. (A) Western blot detection. (B) Quantitative analysis of protein expression. Notes: * p < 0.05, ** p < 0.01 vs. inhibitor NC (ANOVA analysis followed by Tukey’s post hoc test). The error bars represent standard deviation (SD), n = 3

Full size image

Prediction and validation of mir-144-5ptarget gene binding sites

To fully elucidate the mechanism of action of miR-144-5p, we used TargetScanHuman7.2 [36] to predict the target genes of miR-144-5p, and reviewed the literature and found that Atg2A can form heteromeric complexes necessary for autophagosome journey to promote autophagy [37]. The dual luciferase assays were used to validate its target. The results showed that Atg2A was a target of miR-144-5p (Fig. 7A). The expression of Atg2A was significantly decreased after overexpression of miR-144-5p, whereas miR-144-5p inhibition promoted the expression of Atg2A (Fig. 7B-C).

Fig. 7
figure 7

Verification of miR-144-5P target genes and detection of Atg2A expression in each group. (A) Dual luciferase reporter assay detection. (B) Detection of Atg2A expression by qPCR. (C) Detection of Atg2A expression by Western blot. * p < 0.05, ** p < 0.01 vs. mimic-NC or inhibitor NC (ANOVA analysis followed by Tukey’s post hoc test). The error bars represent standard deviation (SD), n = 3

Full size image

MiR-144-5p affects myoblast senescence, myogenic differentiation and autophagy negatively regulated by downstream target genes

By examining senescent cells with β-GAL staining, influence of miR-144-5p and Atg2A on myoblasts’ cellular senescence, myogenic differentiation, and autophagy was determined. Compared with the mimic-NC group, SA-β-GAL staining intensity increased in the hsa-miR-144-5p group but decreased in the mimic-NC + Atg2A group, and there was little difference in SA-β-GAL staining intensity in the hsa-miR-144-5p mimic + Atg2A group (Fig. 8A). Compared with the control group mimic-NC, the expression of MHC was significantly decreased in the hsa-miR-144-5p group but significantly increased in the mimic-NC + Atg2A group (p < 0.05). The expression of MHC in the hsa-miR-144-5p mimic + Atg2A group was similar to that of the control group with no significant difference (Fig. 8B-D).

WB was employed to detect senescence-related proteins acetylated p53, p53, and p21, the expression and ratio of autophagy marker LC3II/LC3I, and the expression of Beclin-1, p62, and Atg2A in each group (Fig. 8E-F). Quantitative analysis of the results proved that acetylated p53, p53, p21, and p62 expression was markedly elevated in the hsa-miR-144-5p compared with the control mimic-NC, but significantly decreased in the mimic-NC + Atg2A group (p < 0.05). LC3II/LC3I, Beclin-1, and Atg2A expression was markedly reduced in the hsa-miR-144-5p but increased significantly in the mimic-NC (p < 0.05).

Fig. 8
figure 8

Detection of cell senescence and myogenic differentiation. (A) β-galactosidase staining. (B) Detection of MHC protein expression by Western Blot. (C-D) Immunofluorescence detection of the expression of MHC protein. (E-F) Western Blot detected senescence-related proteins acetylated p53, p53 and p21, the expression and ratio of autophagy marker LC3II/LC3I, and the expression of Beclin-1, p62 and Atg2A in each group. Note: Scale bar = 100 μm in Figure A, Scale bar = 50 μm in figure C. * p < 0.05, ** p < 0.01 vs. mimic-NC (ANOVA analysis followed by Tukey’s post hoc test). The error bars represent standard deviation (SD), n = 3

Full size image

MiR-144-5p-target gene affects the mass and functions of mouse muscles by regulating autophagy

Inhibition of miR-144-5p in old mice significantly elevated the grip strength of mouse posterior limbs (p < 0.05). Conversely, suppression of miR-144-5p in young mice resulted in little change in grip strength of mouse posterior limbs. Compared to old mice, the grip strength of young mouse posterior limbs was significantly greater, and there was no change after inhibiting miR-144-5p (Fig. 9A). Inhibiting miR-144-5p expression greatly affected gastrocnemius muscle weight in old and young mice. The gastrocnemius muscle weight of young mice was higher than that of the old mice (p < 0.05). After inhibiting the expression of miR-144-5p, there was no significant change in gastrocnemius muscle weight in the young and old mice. The gastrocnemius muscle weight of young mice was higher than that of old mice. After inhibiting the expression of miR-144-5p, young mice gained more weight (p < 0.05, Fig. 9B). The muscle fiber cross-sectional area (CSA) of the gastrocnemius muscle was detected using HE staining, and the results indicated that the area of muscle fibers was decreased in old mice. After inhibiting the expression of miR-144-5p, their CSA significantly increased (p < 0.05, Fig. 9C-D).

Inhibition of miR-144-5p expression greatly promoted Atg2A, LC3II/LC3I, and Beclin-1 expression, but significantly reduced p62 expression in old mice (p < 0.05). However, inhibition of miR-144-5p expression had no significant effect on the expression of Atg2A, LC3II/LC3I, Beclin-1, and p62 in young mice. Compared with old mice, the expression of Atg2A, LC3II/LC3I, and Beclin-1 proteins was higher in young mice, while p62 expression was lower (p < 0.05). After inhibiting miR-144-5p, the expression of Atg2A, LC3II/LC3I, and Beclin-1 proteins in young mice was still higher than that in old mice, but p62 expression was lower than in old mice (p < 0.05) (Fig. 9E).

Fig. 9
figure 9

miR-144-5p-target gene affects the mass and functions of mouse muscles by regulating autophagy. (A) Grip strength test in the posterior limbs of mice, n = 6. (B) Gastrocnemius muscle weight measurement, n = 6. (C) Quantitative HE staining results, n = 3. (D) The CSA of the gastrocnemius muscle by HE staining, n = 3. (E) The expression and ratio of Mir-144-5p target gene Atg2A and autophagy-related protein LC3II/LC3I, Beclin-1 and P62 were detected using Western blot, n = 3. Scale bar = 50 μm. Magnification = 400×. * p < 0.05, ** p < 0.01 and *** p < 0.001 (ANOVA analysis followed by Tukey’s post hoc test). The error bars represent standard deviation (SD)

Full size image

Discussion

Sarcopenia, a multifaceted disease stemming from aging and concomitant loss of skeletal muscle mass and strength, invariably leads to mobility challenges such as difficulty in walking, climbing stairs, and carrying objects among older adults [38]. Therefore, exploring the therapeutic targets of sarcopenia for the clinical treatment of patients with sarcopenia is of great significance. With the development of high-throughput sequencing technology, a large number of studies have found that miRNA is closely related to the occurrence and development of sarcopenia [43]. In this study, we used the GEO dataset to screen for miRNA-144-5p associated with sarcopenia. Transfection of miRNA-144-5p inhibitor and mimic into C2C12 cells revealed that inhibition of miR-144-5p promoted myoblast proliferation, reduced cell senescence, and enhanced autophagy. Among the target genes of miRNA-144-5p, Atg2A attracted our attention as it is involved in autophagy and is an essential protein for autophagosome formation. Here, we observed that myogenic differentiation and autophagy in C2C12 cells were effectively promoted after overexpression of miR-144-3p and Atg2A. Moreover, changes in the expression levels of acetylated p53, p53, p21, p62, LC3II/LC3I, and Beclin1 proteins indicated that regulation of autophagy and cell senescence via miR-144-3p/Atg2A may be crucial for sarcopenia.

MiRNA regulates target cells by modulating mRNA expression, playing a crucial function in skeletal muscle growth, development, and metabolic balance [44]. They are key components of the regulatory network of satellite cell-mediated myogenesis [45] and are essential for maintaining muscle protein homeostasis [43]. In this study, miRNAs were identified through GSE23527 dataset, and its significant target genes were predicted. The functions and signaling pathways involved in these target genes mainly include the PI3K-Akt signaling pathway, regulation of the apoptotic signaling pathway, cell-cell junction, and DNA-binding transcription activator activity. Among the identified miRNAs, miR-144 is related to many diseases, such as fracture healing [46], ovarian failure [47], colorectal cancer [48], depression [49], etc. The results of this study showed that inhibiting miR-144-5p expression could promote the proliferation of mouse myoblasts and MHC expression and reduce the number of senescent cells. In contrast, the overexpression of miR-144-5p had the opposite effect (Fig. 2). Moreover, Inhibiting the expression of miR-144-5p reduced the expression of senescence-related proteins acetylated p53, p53, and p21 in mouse myoblasts, increased autophagy LC3II/LC3I and Beclin-1 expression (Fig. 3), and promoted the formation of autophagosomes in mouse myoblasts (Fig. 4). p62, a specific autophagy substrate, serves as a reporter for autophagic activity and is involved in the proteasomal degradation of ubiquitinated proteins. p62 localizes to autophagosomes through direct interaction with LC3 and is continuously degraded by the autophagy-lysosome system. Ablation of autophagy leads to a marked accumulation of p62 [50]. Studies have shown that p62 accumulation contributes to disrupted autophagy: under conditions of impaired autophagy, p62 forms aggregates with ubiquitinated proteins. These aggregates accumulate in the liver, potentially resulting in hepatocyte dysfunction and signs of oxidative and electrophilic stress, similar to the phenotypes observed in liver-related diseases, such as hepatocellular carcinoma [51]. However, p62 interacts with several signaling molecules, including Keap1-Nrf2 and mTOR, influencing its transcriptional synthesis. Therefore, when assessing autophagic activity using p62, other markers, such as LC3II/LC3I and Beclin-1, should also be used [52]. Our data demonstrate that inhibition of miR-144-5p expression promotes autophagy, increases LC3II/LC3I and Beclin-1 expression, and suppresses p62 protein expression.

MiR-144-5p is a multifunctional microRNA exhibiting a broad range of regulatory effects across various diseases. It participates in the modulation of multiple key cellular processes by targeting diverse genes and signaling pathways. In non-small cell lung cancer, miR-144-5p enhances the sensitivity of non-small cell lung cancer cells to radiation therapy [53]. In esophageal cancer cells, high expression of miR-144-5p induces apoptosis and inhibits cell migration, invasion, and proliferation by suppressing the MYC Proto-Oncogene Protein (Myc) and phosphorylated extracellular signal-regulated kinase (P-ERK) signaling pathways [54]. In atherosclerosis, miR-144-5p regulates the proliferation, apoptosis, invasion, and migration of human umbilical vein endothelial cells via the SMAD signaling pathway [55]. Additionally, miR-144-5p is involved in the regulation of inflammatory responses through phosphatase and tensin homolog (PTEN) and TLR2 [49, 56]. Autophagy is a fundamental cellular process crucial for maintaining homeostasis through the lysosomal degradation of damaged organelles and misfolded proteins [57]. Autophagy exerts complex and reciprocal effects on musculoskeletal diseases [58]. Notably, studies have demonstrated that the activation of autophagy is a significant contributor to the pathogenesis of sarcopenia in senescence-accelerated mouse prone 8 (SAMP8) models [60]. Conversely, impaired autophagy has been observed in sarcopenic patients, and these autophagic defects are implicated in exacerbating the progression of sarcopenia [61, 62]. Disruption of autophagic processes within muscle tissue can lead to neuromuscular junction degeneration, reduced muscle strength, and accelerated aging phenotypes [63].

We pretreated cells with 3-MA and then transfected them with miR-144-3p inhibitors. This approach was used to assess whether the miR-144-3p inhibitor could reverse the effects of 3-MA on senescence, autophagy inhibition, and myogenic differentiation in mouse myoblasts. In this study, the autophagy inhibitor 3-MA significantly increased SA-β-GAL activity in mouse myoblasts, accompanied by an increase in the expression of senescence-associated proteins acetylated p53, p53, and p21. Concurrently, 3-MA suppressed the expression of MHC protein and the autophagic markers LC3II/LC3I and Beclin-1. The addition of the miR-144-5p inhibitor reversed these effects, suggesting that miR-144-5p modulates cellular senescence and myogenic differentiation via autophagy. Consistent with the action of miR-144-5p, prior research has shown that TRB3 knockout in mice can alleviate muscle fiber atrophy and reduce skeletal muscle fibrosis by increasing autophagy and inhibiting mitogen-activated protein kinase signaling [64]. During aging, skeletal muscle atrophy can be alleviated by the upregulation of autophagy. For example, low levels of Atg5, Atg7, and LC3 were observed in old rats, suggesting that reduced autophagy leads to impaired skeletal muscle function with age [65].

The results of double luciferase confirmed the combination of miR-144-5p and Atg2A. ATG2 is a punctate protein located around the vacuoles of autophagy precursors and is divided into two types: A and B. Atg2A can promote the extension and closure of autophagosomes [66, 67]. In mammalian cells, loss of Atg2A can block autophagic flux and lead to accumulation of immature autophagosome membranes that promote Caspase-8 activation in response to nutrient deprivation through intracellular death-inducing signaling complexes. By inhibiting the formation of autophagosomes to selectively block autophagic flux, the cell-protective process of autophagy is changed to apoptosis [66]. The current study demonstrated that miR-144-5p affects myoblast senescence, myogenic differentiation, and autophagy by regulating the downstream target gene, Atg2A.

This work proved that, compared with old mice, grip strength of the posterior limb and gastrocnemius muscle weight were apparently greater in young mice. Inhibiting the expression of miR-144-5p markedly increased the grip strength of the posterior limb in old mice, and the CSA of old mice and young mice was also markedly increased (Fig. 9). At the muscle fiber level, sarcopenia is characterized by type II muscle fiber atrophy, increased fiber necrosis, and decreased fiber cross-linking components and mitochondria [68]. Studies have shown that the content of type I and type II fibers in the muscles of a 90-year-old individual is only half that in young people [69]. Inhibiting miR-144-5p expression significantly promoted Atg2A, LC3II/LC3I, and Beclin-1 expression, whereas it significantly reduced the expression of p62 in old mice. The expression of Atg2A, LC3II/LC3I, and Beclin-1 proteins was higher in young mice, while the expression of p62 was lower than that in old mice. Decreased levels of the autophagy-related regulators Bcl2, Bnip3, and GABA receptor-related protein 1 were also observed in the skeletal muscle of old mice, thereby disrupting the contraction and metabolic functions of the skeletal muscle [70]. It has been shown that miR-144-5p can significantly regulate autophagy in old mice and protect muscle tissue by regulating autophagy.

In summary, the results of this study found that miRNA-144-5p affects autophagy through regulating Atg2A, thereby affecting age-related sarcopenia. The research results enrich the physiological and pathological mechanisms of sarcopenia and provide new therapeutic targets for sarcopenia. However, since the current research findings are based on preliminary discoveries from mouse models, further experiments are needed before they can be applied clinically. The key findings should be validated in human myoblast cells. More experiments need to be designed in vivo to prove the regulation of miR-144-5p in sarcopenia.

Conclusions

The miRNA-144-5p associated with sarcopenia was screened using GEO datasets in this study. The experimental findings proved that inhibiting miR-144-5p promoted the proliferation of myoblasts, reduced cell senescence, promoted autophagy, and significantly increased grip strength and CSA of posterior limbs in aged mice. In conclusion, this study demonstrated that miRNA-144-5p can affect the occurrence of senile sarcopenia by regulating autophagy, which provides a new therapeutic direction for the clinical treatment of sarcopenia. This study did not involve specific drugs or treatment methods and focused only on miRNA-144-5p. Therefore, further exploration of specific drug control of miRNA-144-5p expression regulation and application scenarios is necessary.

Data availability

All data used in the study appear in the submitted article.

References

  1. Traub J, Bergheim I, Eibisberger M, Stadlbauer V. Sarcopenia and Liver cirrhosis-comparison of the European Working Group on Sarcopenia Criteria 2010 and 2019. Nutrients Feb. 2020;20(2). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/nu12020547.

  2. Li P, Ding L, Zhen J, Hu J, Fan Y, Liu M. Association of subtle alterations in thyroid function with presarcopenia in patients with type 2 diabetes mellitus. J Diabetes Investig. 2022;13(4):696–705. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/jdi.13703.

    Article  PubMed  CAS  Google Scholar 

  3. Guo C-Y, Ma Y-J, Liu S-T, et al. Traditional Chinese Medicine and Sarcopenia: a systematic review. Front Aging Neurosci. 2022;14:872233. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fnagi.2022.872233.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  4. Bian A, Ma Y, Zhou X, et al. Association between Sarcopenia and levels of growth hormone and insulin-like growth factor-1 in the elderly. BMC Musculoskelet Disord. 2020;21(1):214. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12891-020-03236-y.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  5. Spanoudaki M, Giaginis C, Mentzelou M, et al. Sarcopenia and Sarcopenic Obesity and osteoarthritis: a discussion among muscles, Fat, bones, and aging. Life. 2023;13(6):1242.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  6. Jang JY, Kim D, Kim ND. Pathogenesis, intervention, and current status of Drug Development for Sarcopenia: a review. Biomedicines. 2023;11(6):1635.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  7. Kim J, Lee J-Y, Kim CY. A Comprehensive Review of pathological mechanisms and natural dietary ingredients for the Management and Prevention of Sarcopenia. Nutrients. 2023;15(11):2625.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  8. Nakajima H, Okada H, Kobayashi A, et al. Leucine and glutamic acid as a biomarker of sarcopenic risk in Japanese people with type 2 diabetes. Nutrients. 2023;15(10):2400.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  9. Kim Y. Drug Discovery perspectives of antisense oligonucleotides. Biomolecules & therapeutics. May. 2023;1(3):241–52. https://doiorg.publicaciones.saludcastillayleon.es/10.4062/biomolther.2023.001.

    Article  CAS  Google Scholar 

  10. Lieberman J. Tapping the RNA world for therapeutics. Nature Structural & Molecular Biology. 2018/05/01 2018;25(5):357–364. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41594-018-0054-4

  11. Paunovska K, Loughrey D, Dahlman JE. Drug delivery systems for RNA therapeutics. Nature Reviews Genetics. 2022/05/01 2022;23(5):265–280. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41576-021-00439-4

  12. Chen J, Zhou C, Yi J, et al. Metformin and arsenic trioxide synergize to trigger Parkin/pink1-dependent mitophagic cell death in human cervical cancer HeLa cells. J Cancer. 2021;12(21):6310–9. https://doiorg.publicaciones.saludcastillayleon.es/10.7150/jca.61299.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  13. Yoshida N, Endo J, Kinouchi K, et al. (Pro)renin receptor accelerates development of Sarcopenia via activation of Wnt/YAP signaling axis. Aging Cell. 2019;18(5):e12991. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/acel.12991.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  14. Wang W, Shen D, Zhang L, et al. SKP-SC-EVs mitigate denervated muscle atrophy by inhibiting oxidative stress and inflammation and improving Microcirculation. Antioxid (Basel). 2021;11(1). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/antiox11010066.

  15. Barbiera A, Pelosi L, Sica G, Scicchitano BM. Nutrition and microRNAs: Novel insights to fight Sarcopenia. Antioxid (Basel). 2020;9(10). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/antiox9100951.

  16. Aas SN, Hamarsland H, Cumming KT, et al. The impact of age and frailty on skeletal muscle autophagy markers and specific strength: a cross-sectional comparison. Experimental Gerontol Oct 1. 2019;125:110687. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.exger.2019.110687.

    Article  CAS  Google Scholar 

  17. Anand A, Nambirajan A, Kumar V et al. Alterations in Autophagy and Mammalian Target of Rapamycin (mTOR) Pathways Mediate Sarcopenia in Patients with Cirrhosis. Journal of Clinical and Experimental Hepatology. 2022/03/01/ 2022;12(2):510–518. doi:https://doi.org/10.1016/j.jceh.2021.05.004.

  18. Hansen M, Rubinsztein DC, Walker DW. Autophagy as a promoter of longevity: insights from model organisms. Nat Rev Mol Cell Biol. 2018;19(9):579–93. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41580-018-0033-y.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  19. Mei K, Chen Z, Huang L, Wang J, Wei Y. Correlation between the immune microenvironment and bladder cancer based on a prognostic miRNA risk model. Cancer Insight. 2024;3(2):14–25.

    Google Scholar 

  20. Gebert LFR, MacRae IJ. Regulation of microRNA function in animals. Nature Reviews Molecular Cell Biology. 2019/01/01 2019;20(1):21–37. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41580-018-0045-7

  21. Lin Y, Wen-Jie Z, Chang-Qing L, Sheng-Xiang A, Yue Z. mir-22-3p/KLF6/MMP14 axis in fibro-adipogenic progenitors regulates fatty infiltration in muscle degeneration. FASEB Journal: Official Publication Federation Am Soc Experimental Biology Sep. 2020;34(9):12691–701. https://doiorg.publicaciones.saludcastillayleon.es/10.1096/fj.202000506R.

    Article  CAS  Google Scholar 

  22. Wosczyna MN, Perez Carbajal EE, Wagner MW, et al. Targeting microRNA-mediated gene repression limits adipogenic conversion of skeletal muscle mesenchymal stromal cells. Cell stem cell Jul. 2021;1(7):1323–e13348. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.stem.2021.04.008.

    Article  CAS  Google Scholar 

  23. Liang J-L, Xie J-F, Wang C-Y, Chen N. [Regulatory roles of microRNAs in Sarcopenia and exercise intervention]. Sheng Li Xue Bao. 2020;72(5):667–76.

    PubMed  Google Scholar 

  24. Fochi S, Giuriato G, De Simone T, et al. Regulation of microRNAs in Satellite Cell Renewal, muscle function, Sarcopenia and the role of Exercise. Int J Mol Sci. 2020;21(18). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ijms21186732.

  25. Li J, Wang R, Ge Y, Chen D, Wu B, Fang F. Assessment of microRNA-144-5p and its putative targets in inflamed gingiva from chronic periodontitis patients. J Periodontal Res Jun. 2019;54(3):266–77. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/jre.12627.

    Article  CAS  Google Scholar 

  26. Kim JK, Lee HM, Park KS, et al. MIR144* inhibits antimicrobial responses against Mycobacterium tuberculosis in human monocytes and macrophages by targeting the autophagy protein DRAM2. Autophagy Feb. 2017;13(2):423–41. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/15548627.2016.1241922.

    Article  CAS  Google Scholar 

  27. Zhou G, Li Y, Ni J, Jiang P, Bao Z. Role and mechanism of mir-144-5p in LPS-induced macrophages. Experimental Therapeutic Med Jan. 2020;19(1):241–7. https://doiorg.publicaciones.saludcastillayleon.es/10.3892/etm.2019.8218.

    Article  CAS  Google Scholar 

  28. Drummond MJ, McCarthy JJ, Sinha M, et al. Aging and microRNA expression in human skeletal muscle: a microarray and bioinformatics analysis. Physiological Genomics May. 2011;1(10):595–603. https://doiorg.publicaciones.saludcastillayleon.es/10.1152/physiolgenomics.00148.2010.

    Article  CAS  Google Scholar 

  29. Wu T, Hu E, Xu S, et al. clusterProfiler 4.0: a universal enrichment tool for interpreting omics data. Innov (Cambridge (Mass)) Aug. 2021;28(3):100141. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.xinn.2021.100141.

    Article  CAS  Google Scholar 

  30. Shannon P, Markiel A, Ozier O, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res Nov. 2003;13(11):2498–504. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/gr.1239303.

    Article  CAS  Google Scholar 

  31. Xiang Y, Zheng Y, Liu S, Liu G, Li Z, Dong W. Comparison of the sensitivity of Western blotting between PVDF and NC membranes. Sci Rep. 2021;06(1):12022. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-021-91521-8. /08 2021.

    Article  CAS  Google Scholar 

  32. Liao SX, Chen J, Zhang LY, Zhang J, Sun PP, Ou-Yang Y. Effects of SOCS1-overexpressing dendritic cells on Th17- and Treg-related cytokines in COPD mice. BMC Pulmonary Med Apr. 2022;15(1):145. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12890-022-01931-1.

    Article  CAS  Google Scholar 

  33. Yedigaryan L, Sampaolesi M. Therapeutic implications of miRNAs for muscle-wasting conditions. Cells Nov. 2021;5(11). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/cells10113035.

  34. Liu GM, Lu TC, Sun ML, Jia WY, Ji X, Luo YG. Ginsenoside Rd inhibits Glioblastoma Cell Proliferation by Up-Regulating the expression of miR-144-5p. Biol Pharm Bull. 2020;43(10):1534–41. https://doiorg.publicaciones.saludcastillayleon.es/10.1248/bpb.b20-00338.

    Article  PubMed  CAS  Google Scholar 

  35. Wang Z, Zhang M, Li K, et al. CircMGA depresses myoblast proliferation and promotes myotube formation through miR-144-5p/FAP Signal. Animals: Open Access J MDPI Mar. 2022;30(7). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ani12070873.

  36. Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNA target sites in mammalian mRNAs. eLife. Aug 12. 2015;410.7554/eLife.05005

  37. van Vliet AR, Chiduza GN, Maslen SL, et al. ATG9A and ATG2A form a heteromeric complex essential for autophagosome formation. Mol cell Nov. 2022;17(22):4324–e43398. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.molcel.2022.10.017.

    Article  CAS  Google Scholar 

  38. Saud Gany SL, Chin KY, Tan JK, Aminuddin A, Makpol S. Curcumin as a Therapeutic Agent for Sarcopenia. Nutrients May. 2023;29(11). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/nu15112526.

  39. Jang JY, Kim D, Kim ND. Pathogenesis, intervention, and current status of Drug Development for Sarcopenia: a review. Biomedicines. 2023;11(6). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/biomedicines11061635.

  40. Wetzlich B, Nyakundi BB, Yang J. Therapeutic applications and challenges in myostatin inhibition for enhanced skeletal muscle mass and functions. Mol Cell Biochem. 2024/09/28 2024;https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s11010-024-05120-y

  41. Bauer JM, Verlaan S, Bautmans I, et al. Effects of a vitamin D and leucine-enriched whey protein nutritional supplement on measures of Sarcopenia in older adults, the PROVIDE study: a randomized, double-blind, placebo-controlled trial. J Am Med Dir Assoc. Sep 2015;1(9):740–7. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.jamda.2015.05.021.

    Article  Google Scholar 

  42. Waterhouse M, Sanguineti E, Baxter C et al. Dec. Vitamin D supplementation and risk of falling: outcomes from the randomized, placebo-controlled D-Health Trial. Journal of cachexia, sarcopenia and muscle. 2021;12(6):1428–1439. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/jcsm.12759

  43. Yin J, Qian Z, Chen Y, Li Y, Zhou X. MicroRNA regulatory networks in the pathogenesis of Sarcopenia. 2020;24(9):4900–12. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/jcmm.15197

  44. Zhang G, He M, Wu P, et al. MicroRNA-27b-3p targets the myostatin gene to regulate myoblast proliferation and is involved in myoblast differentiation. Cells Feb. 2021;17(2). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/cells10020423.

  45. Xu M, Chen X, Chen D et al. Regulation of skeletal myogenesis by microRNAs. J Cell Physiol. 2020;235(1):87–104.

  46. Zhang D, Wu Y, Li Z, et al. MiR-144-5p, an exosomal miRNA from bone marrow-derived macrophage in type 2 diabetes, impairs bone fracture healing via targeting Smad1. J Nanobiotechnol. 2021;19:1–17.

    Google Scholar 

  47. Yang M, Lin L, Sha C, et al. Bone marrow mesenchymal stem cell-derived exosomal mir-144-5p improves rat ovarian function after chemotherapy-induced ovarian failure by targeting PTEN. Lab Invest. 2020;100(3):342–52.

    Article  PubMed  CAS  Google Scholar 

  48. Gao Z, Jiang J, Hou L, Zhang BJJ. Dysregulation of MiR-144-5p/RNF187 axis contributes to the progression of colorectal cancer. J Translational Intern Med. 2022;10(1):65–75.

    Article  Google Scholar 

  49. Wu X, Zhang Y, Wang P, et al. Clinical and preclinical evaluation of mir-144-5p as a key target for major depressive disorder. CNS Neurosci Ther Nov. 2023;29(11):3598–611. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/cns.14291.

    Article  CAS  Google Scholar 

  50. Komatsu M, Ichimura Y. Physiological significance of selective degradation of p62 by autophagy. FEBS Letters. 2010/04/02/ 2010;584(7):1374–1378. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.febslet.2010.02.017

  51. Komatsu M, Waguri S, Koike M, et al. Homeostatic levels of p62 control cytoplasmic inclusion body formation in autophagy-deficient mice. Cell. 2007;131(6):1149–63. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.cell.2007.10.035.

    Article  PubMed  CAS  Google Scholar 

  52. Liu WJ, Ye L, Huang WF, et al. p62 links the autophagy pathway and the ubiqutin-proteasome system upon ubiquitinated protein degradation. Cell Mol Biol Lett. 2016;21:29. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s11658-016-0031-z.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  53. Song L, Peng L, Hua S, et al. Mir-144-5p enhances the Radiosensitivity of Non-small-cell Lung Cancer cells via Targeting ATF2. Biomed Res Int. 2018;2018:5109497. https://doiorg.publicaciones.saludcastillayleon.es/10.1155/2018/5109497.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  54. Gao Z, Zhang P, Xie M, Gao H, Yin L, Liu R. miR-144/451 cluster plays an oncogenic role in esophageal cancer by inhibiting cell invasion. Cancer Cell Int. 2018;18:184. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12935-018-0679-8.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  55. Fu W, Liu Z, Zhang J, Shi Y, Zhao R, Zhao H. Effect of microRNA-144-5p on the proliferation, invasion and migration of human umbilical vein endothelial cells by targeting SMAD1. Experimental and therapeutic medicine. Jan. 2020;19(1):165–71. https://doiorg.publicaciones.saludcastillayleon.es/10.3892/etm.2019.8194.

    Article  CAS  Google Scholar 

  56. Shi X, Ma W, Li Y, et al. MiR-144-5p limits experimental abdominal aortic aneurysm formation by mitigating M1 macrophage-associated inflammation: suppression of TLR2 and OLR1. J Mol Cell Cardiol Jun. 2020;143:1–14. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.yjmcc.2020.04.008.

    Article  CAS  Google Scholar 

  57. Anding AL, Baehrecke EH. Cleaning House: selective autophagy of Organelles. Dev cell Apr. 2017;10(1):10–22. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.devcel.2017.02.016.

    Article  CAS  Google Scholar 

  58. Rodrigues ACZ, Wang ZM, Messi ML et al. Heart and neural crest derivative 2-induced preservation of sympathetic neurons attenuates Sarcopenia with aging. J Cachexia Sarcopenia Muscle. 2021;12(1):91–108.

  59. Xie G, Jin H, Mikhail H et al. Autophagy in Sarcopenia: possible mechanisms and novel therapies. Biomed Pharmacother. 2023;165:115147.

  60. Chang YC, Chen YT, Liu HW et al. May. Oligonol Alleviates Sarcopenia by Regulation of Signaling Pathways Involved in Protein Turnover and Mitochondrial Quality. Molecular nutrition & food research. 2019;63(10):e1801102. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/mnfr.201801102

  61. Nichenko AS, Sorensen JR, Southern WM, et al. Lifelong Ulk1-Mediated Autophagy Deficiency in muscle induces mitochondrial dysfunction and contractile weakness. Int J Mol Sci Feb. 2021;16(4). https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ijms22041937.

  62. Xie G, Jin H, Mikhail H, et al. Autophagy in Sarcopenia: possible mechanisms and novel therapies. Biomed Pharmacotherapy = Biomedecine Pharmacotherapie Sep. 2023;165:115147. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.biopha.2023.115147.

    Article  CAS  Google Scholar 

  63. Aversa Z, Zhang X, Fielding RA, Lanza I, LeBrasseur NK. The clinical impact and biological mechanisms of skeletal muscle aging. Bone Oct. 2019;127:26–36. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.bone.2019.05.021.

    Article  CAS  Google Scholar 

  64. Shang GK, Han L, Wang ZH, et al. Sarcopenia is attenuated by TRB3 knockout in aging mice via the alleviation of atrophy and fibrosis of skeletal muscles. J cachexia Sarcopenia Muscle Aug. 2020;11(4):1104–20. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/jcsm.12560.

    Article  Google Scholar 

  65. Wang C, Liang J, Ren Y, et al. A preclinical systematic review of the effects of Chronic Exercise on Autophagy-related proteins in aging skeletal muscle. Front Physiol. 2022;13:930185. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fphys.2022.930185.

    Article  PubMed  PubMed Central  Google Scholar 

  66. Tang Z, Takahashi Y, Chen C, et al. Atg2A/B deficiency switches cytoprotective autophagy to non-canonical caspase-8 activation and apoptosis. Cell Death Differ Dec. 2017;24(12):2127–38. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/cdd.2017.133.

    Article  CAS  Google Scholar 

  67. Campbell GR, To RK, Zhang G, Spector SA. SMAC mimetics induce autophagy-dependent apoptosis of HIV-1-infected macrophages. Cell Death Disease Jul. 2020;27(7):590. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41419-020-02761-x.

    Article  CAS  Google Scholar 

  68. Aldahhan RA, Motawei KH, Al-Hariri MT. Lipotoxicity-related Sarcopenia: a review. J Med Life. 2022;15(11):1334–9. https://doiorg.publicaciones.saludcastillayleon.es/10.25122/jml-2022-0157.

    Article  PubMed  PubMed Central  Google Scholar 

  69. Sakuma K, Yamaguchi A. Sarcopenic obesity and endocrinal adaptation with age. Int J Endocrinol. 2013;2013:204164. https://doiorg.publicaciones.saludcastillayleon.es/10.1155/2013/204164.

    Article  PubMed  PubMed Central  Google Scholar 

  70. Kim MJ, Febbraro D, Farkona S, et al. Distinct roles of UVRAG and EGFR signaling in skeletal muscle homeostasis. Mol Metab. 2021;47:101185. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.molmet.2021.101185.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

Download references

Acknowledgements

Not applicable.

Funding

This work was supported by the National Natural Science Foundation of Chongqing (CSTC2021jcyj-msxmX0695), the Scientific Research Project of Chongqing Sports Bureau, the Yong and Middle-aged Senior Medical Talents studio of Chongqing (ZQNYXGDRCGZS2019007), the Chongqing Natural Science Foundation (CSTB2022NSCQ-MSX1574), the Chongqing Natural Science Foundation (CSTB2022NSCQ-MSX1574), and Chongqing Municipal Education Commission Key Scientific Research Project (KJZD-K202400101)

Author information

Author notes

  1. Mengdie Hu and Ying Zhang contributed equally to this study and Co-first authors.

Authors and Affiliations

  1. Department of Orthopedics, Central Hospital of Chongqing University, Chongqing, 400030, China

    Mengdie Hu, Ying Zhang, Hong Ding, Rui Chao & Zhidong Cao

Authors
  1. Mengdie Hu
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Ying Zhang
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Hong Ding
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Rui Chao
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Zhidong Cao
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

Conceptualization, Mengdie Hu, Ying Zhang, and Zhidong Cao; methodology, Hong Ding; Experiment, Mengdie Hu, Ying Zhang and Hong Ding; Data analysis, Rui Chao; writing—original draft preparation, Mengdie Hu and Ying Zhang; writing—review and editing, Zhidong Cao, Hong Ding, and Rui Chao. All the authors have read and agreed to the published version of the manuscript.

Corresponding author

Correspondence to Zhidong Cao.

Ethics declarations

Ethics approval and consent to participate

This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The animal experiments are performed following ARRIVE guidelines (https://arriveguidelines.org) and the protocol was approved by The Animal Ethics and Management Committee of The Central Hospital of Chongqing University.

Consent for publication

Not applicable.

Clinical number trial

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Hu, M., Zhang, Y., Ding, H. et al. Effect and mechanism of miRNA-144-5p-regulated autophagy in older adults with Sarcopenia. Immun Ageing 22, 7 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12979-025-00499-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12979-025-00499-8

Keywords

Immunity & Ageing

ISSN: 1742-4933

Contact us